In this lab, we will simulate the work of forensic scientists by using restriction enzymes to cut DNA samples and perform and interpret gel electrophoresis.

Pre-Lab Questions:

Answer the following questions and copy the data table in your interactive notebook:

What makes a person's DNA unique?
The nucleus of each cell in a person has DNA inside. What can be said about the DNA found there?

Materials

Tape
Lab paper
Scissors
Computer
Printer
Paper

Procedure

Print out the DNA samples and copy the data table below into your notebook.
Write the complimentary sequence on each sample on the blank line provided. (Remember: A binds to T and G binds to C.)
In this lab, the restriction enzyme that cuts the DNA recognizes the sequence AGCT and cuts between the A and the G. Find each sequence that is AGCT and draw a line between the A and the G. Remember to make this mark on both the sequence provided and the sequence you filled in. Then draw a line connecting these.
Using scissors, cut out each sample and cut along where the restriction enzyme cuts (where you drew your lines). Hint: Don’t mix up your samples.
After cutting your samples, arrange them on the data table according to size (longest to shortest). Use tape to fix them to the page.

Note: Keep all of Sample A together, all of Sample B together, etc.

Data Table

Sample A

Sample B

Sample C

Sample D

Print out these DNA samples and cut on the outside line of the box

DNA found at crime scene (Sample A)

ACGTCGTCTCTAGCTAGATCGACTATACGACTAGCTCGATAGATATAAA

DNA from suspect 1 (Sample B)

ACGTCGTCTCTAGCTAGATCAGCTATACGACTAGCATCGATAGATATAA

DNA from suspect 2 (Sample C)

ACGTCGTCTCTAGCTAGATCGACTATACGACTAGCTCGATAGATATAAA

DNA from suspect 3 (Sample D)

ACGTCAGCTCTAGCTAGATCGACTATACGACTACCTTCGATAGATATAA

Post-Lab Questions:

Based on the investigation findings outlined above, answer the following questions in your interactive notebook in complete sentences:

Which sample matched the DNA found at the crime scene?

How do you know it matched?

3. How does electrophoresis separate DNA?